Figure 1: mRNA code.
Full Text
Mihai Bojescu*
Collège et École de Commerce Émilie-Gourd, Geneva, Switzerland
*Corresponding author: Mihai Bojescu, Collège et École de Commerce Émilie-Gourd, Geneva, Switzerland; E-mail: misubojescu@gmail.com
Background: This research paper analyzes how to treat cancer with a virus. It is known since the 1960s that viruses could be used to fight against cancers.
Methods: To answer this question, we analyzed the receptors that mutate when the genetic code becomes corrupt, then we analyzed the standard VP1 protein of two viruses of the same family. After that, we combined these two elements. Then we studied the REP genes and their impact on the virus entrance and replication. Finally, we examined the protocol of the synthesis of a rAAV.
Results: Our results showed that the protocol is applicable and that we would obtain a virus specially designed to kill the cancer cells. This virus would have a fully operational DNA, which would contain the VP1/2/3 genomic code, the REP genes, and the ITR regions.
Conclusion: This research is only theoretical, and all the steps and methods are based on a strong theoretic basis. The experimentation has not been made. We did not have the material to test them, but we tried to consider all the impacting factors. Our study has shown that a treatment against cancer consisting of a virus could be possible.
Cancer; VP1 Protein; REP Genes; rAAV
SOC: Super Optimal Broth; LB: Luria Broth; µg/ml: micrograms per milliliter; 37° C: 37 Celsius degrees; E. Coli: Escherichia Coli; Min: Minutes; Sec: Seconds; Rpm: Rotations Per Minute; 1 hr: 1 Hour; CDS: Coding DNA Sequences; Poly T-tail: Poly Thymine tail; PCR: Polymerase Chain Reaction; IVT: In vitro Transcription; eGFP: Green Fluorescent Protein; T: Thymidines; NTP/cap: Nucleoside triphosphate/cap; DPBS: Dulbecco’s Phosphate-Buffered Saline; IPNV: Infectious Pancreatic Necrosis Virus; EDTA-free: Ethylene diaminetetraacetic acid-free; Tris: Trisaminomethane; IPNV RDRP: Infectious Pancreatic Necrosis RNA-Dependent RNA Polymerase; ATP: Adenosine Triphosphate; GTP: Guanosine-5’-Triphosphate; CTP: Cytidine Triphosphate; UTP: Uridine-5’-Triphosphate; PMOL: Picomole; PPV: Porcine Parvovirus; PPV-VP2 FD: Porcine Parvovirus VP2 protein; SF9: Spodoptera Frugiperda 9; IMAC: Immobilized Metal Affinity Chromatography; Anti-PPV: Anti Porcine Parvovirus; MMTV-LTR: Mouse Mammary Tumor Virus Long Terminal Repeat; P-globin: Platypus β-globin; SDS: Sodium Dodecyl Sulfate; RCA: Rolling Circle Replication; PABS: Polyclonal Antibodies; PLC7: Phosphoinositide Phospholipase C 7; PLC5: Phosphoinositide Phospholipase C 5; PLC8: Phosphoinositide Phospholipase C 8; E1: Unimolecular Elimination; CMV: Human Cytomegalovirus; E3: Ubiquitin Ligase; pCA35: Principal Component Analysis 35; ORF: Open Reading Frame; CsCl: Cesium Chloride
This research is extremely important. It could allow the eradication of cancer from the earth. It is a major step in oncogenesis, and it could provide a large amount of fame to the journal that would publish it.
To this day, due to numerous environmental and genetic factors, the number of new cancer cases increases, demanding a new way to treat this disease.
The propriety of oncolytic viruses has been realized in the 60s and the first vectors have been used in early 2000. The problem was that these viruses were only useful for specified tissues in a specific organ. This new theoretical treatment is important because it can treat 27 different cancers with the adenovirus.
Although the researches made in the mid-20 century were valuable, the technology to create synthetic viruses was not developed yet, which lead to the research of natural oncolytic viruses. This approach was not concluded with success.
We conducted this research with the scope to find a specific protein that mutates when a genetic mutation occurs. This contact protein is the atypical chemokine receptor 3. By using this mutated receptor, a virus could enter cancer cells only. The most positive point is that 27 different tissues have this receptor. These organs are:
1. The Thyroid gland
2. The Lungs
3. The Salivary gland
4. The Esophagus
5. The Stomach
6. The Duodenum
7. The Small Intestine
8. The Colon
9. The Rectum
10. The Liver
11. The Gallbladder
12. The Pancreas
13. The Kidney
14. The Urinary Bladder
15. The Testis
16. The Epididymis
17. The Fallopian tube
18. The Endometrium
19. The Breast
20. The Hearth
21. The Skeletal
22. The Adipose tissue
23. The Soft tissue
24. The Skin
25. The Appendix
26. The Lymph node
27. The Tonsil
The research conducted by NCBI has proved that a new way of protein expression was possible. I used their way of protein expression. This method consists of ten steps.
We pre-warm the SOC (Super optimal broth) medium to room temperature and the LB (Luria broth) agar plates containing 100 µg/ ml ampicillin to 37° C. Then, we equilibrate the water bath to 42° C (Figure 1).
We thaw one vial of chemically component E. coli on ice.
After that, we add 1-5 µl of the plasmid (10 pg to 100 ng) containing the CDS into the vial of chemically component E. coli and we mix gently. After adding plasmids, we mix by tapping the tube gently. After that, we incubated the mixture on ice for 30 min. Then, we heat-shock the E. coli for 30 sec at 42° C in a water bath without shaking and place the vial on ice for 2 min. Then, we add 250 µl of pre-warmed SOC medium to the E. coli and shack the bacteria horizontally at 300 rpm for 1 hr at 37° C in a bacterial incubator. After that, we spread 100 µl and 150 µl from the transformation mix on pre-warm LB agar plates and invert the plates and incubate them overnight at 37° C. After colonies become visible, we inoculate a single colony from each plate into a 15 ml culture tube containing 5 ml LB medium with 100 µg/ml ampicillin. Then, we incubate them overnight at 37° C with shaking at 300 rpm until the culture is in the late log or stationary phase. Then, we isolate the plasmids containing the required CDS and we determine the plasmid concentration using a spectrophotometer. We also prepare aliquots of 20 µl and store them at -20° C for a prolonged time.
Amplification of plasmid inserts and adding of poly T-tail (Poly thymine tail) by polymerase chain reaction (PCR)
To obtain the DNA template for the in vitro transcription, (IVT) (in vitro transcription) eGFP (Green fluorescent protein) is amplified using PCR (polymerase chain reaction). Simultaneously, a poly T-tail of 120 thymidines (T) is added to the insert by using a reverse primer with a T120 extension. Thereby, the generated mRNAs obtain a poly A-tail with a defined length after the IVT. Then, we prepare the PCR mixture and we mix the reaction. After that, we place the PCR tubes in a thermocycler and run the PCR using the PCR cycling protocol. We also clean up the PCR reaction using PCR purification kit according to the manufacturer’s instructions and elute the DNA using 20 µl nuclease-free water. We also measure the concentration of the DNA using a spectrophotometer. Finally, we freeze the DNA at -20° C for a long time or use it directly for IVT.
In vitro transcription (IVT)
After PCR, the plasmid inserts are amplified and a poly T-tail is added. Then, we prepare the NTP/cap (Nucleoside triphosphate/cap) analog mixture as described in. We also mix the NTP/cap analog mixture thoroughly by vortexing and spin down briefly. After that, we mix the IVT reaction mixture thoroughly by gently pipetting up and down. Then, we centrifuge the PCR tube briefly to collect the mixture at the bottom of the tube. We also incubate at 37° C for 3 hr in a thermomixer. To remove the template DNA, we add 1 µl of DNase (2 U/µl) to the IVT reaction mixture. Then, we mix well and incubate for 15 min at 37° C. After this process, we purify the reaction mixture using an RNA purification kit. We also elute the modified mRNA from the spin column membrane twice with 40 µl nuclease-free water.
Treatment of purified mRNA with antarctic phosphatase
We add 9 µl of 10X Antarctic phosphatase reaction buffer to 79 µl of purified mRNA solution. Subsequently, 2 µl of Antarctic phosphatase is added (5 U/µl) and the sample is gently mixed. The reaction mixture is incubated at 37° C for 30 min.
Then, we purify the reaction mixture using an RNA purification kit. We also elute the modified mRNA from the spin column membrane twice with 50 µl nuclease-free water.
After that, we measure the concentration of the modified mRNA using a spectrophotometer. We also check that the ratio of absorbance at 260 nm/280. The modified mRNA is aliquoted into single-use aliquots required for transfections and they are stored at -80° C.
Preparing of cells for transfection
We plate 2 × 105 cells (HEK293 cells) per well of 12-well plate and we incubate the cells overnight at 37° C in a cell incubator.
Performing mRNA transfection of cells
We thaw the modified mRNA and we generate the lipoplexes for transfection. 25 µl (2.5 µg) of modified mRNA and 2 µl of cationic lipid transfection reagent to 473 µl Opti-MEM (Minimal Essential Medium) I reduced serum medium is added. We scale up the volumes according to the number of wells to be transfected. We also mix the components gently by pipetting. The transfection mixture is incubated at room temperature for 20 min. The cells are washed with 500 µl DPBS (Dulbecco’s phosphate-buffered saline)/well and we add 500 µl transfection mixture to one well of a 12-well plate. The cells are incubated for 4 hr at 37° C and 5% CO2. Then, we aspirate the transfection mixture and we add 1 ml complete cell culture medium to the cells. They are incubated for 24 hr in the cell incubator.
This is the obtained mRNA code.
According to the research conducted by NCBI, three steps are evidenced: Cloning of VP3, Construction of VP1/VP3, and Assembly of VP2.
Cloning of VP3
A synthetic gene encoding VP3, which are residues 735 to 972 of the IPNV (infectious pancreatic necrosis virus) strains Jasper structural polyprotein, with a DNA sequence optimized for E. coli expression but an unchanged protein sequence is amplified by PCR using KOD DNA polymerase (forward primer,
5′-AAGTTCTGTTTCAGGGCCCGACCGCAAGCGGTATGGATGCAG-3′; reverse primer,
5′-ATGGTCTAGAAAGCTTTAAACTTCACCATCATCACCGCTCG-3′). The PCR product is cloned into the pOPINF expression vector using ligation-independent (Figure 2).
Figure 2: Needed DNA fragment for VP1 genes.
Construction of VP1/VP3
VP3 is expressed in B834 cells grown in the presence of 50 µg/ml carbenicillin. The cultures are also grown at 37° C until the optical density at 600 nm reached 0.6, at which point they are cooled to 20° C and the protein expression is induced by adding 0.5 mM isopropylβ-d-thiogalactopyranoside. The cells are incubated for a further 20 hr, harvested by centrifugation at 8,000 × g; 8° C, 20 min, and they are stored frozen at -80° C. After that, the cell pellets are thawed and resuspended on ice in 50 mM Tris (trisaminomethane), 500 mM NaCl, 50 mM imidazole, and 0.2% (vol/vol), Tween 20 with a pH of 7.5 supplemented with 400 units of bovine pancreas DNase I and with one EDTA-free protease inhibitor cocktail tablet (1 liter). The cells are lysed using either at 30,000 lb/in2 , and the cell lysates are cleared by centrifugation at 35,000 × g, 8° C in 30 min. The cleared lysate is applied to a 1 ml HisTrap Ni2+ affinity column, which is washed with 50 mM Tris, 500 mM NaCl, and 50 mM imidazole at pH of 7.5, and eluted in 50 mM Tris, 500 mM NaCl, and 500 mM imidazole, also at pH 7.5. The eluate is further purified by size exclusion chromatography using the HiLoad 16/60 Superdexat 200 columns equilibrated in 20 mM Tris and 200 mM NaCl of a pH of 7.5 and an ÄKTA Purifier 10 UPC. The fractions containing the purified VP3 are pooled and incubated with 50 µl of rhinovirus 3C protease. We start with a concentration of 2 mg/ ml. Then, we wait overnight at 4° C, to remove the N-terminal His6 tag before they are being passed through a 1 ml of HisTrap Ni2+ affinity. Once purified, the untagged VP3 at 1 mg/ml is mixed with either full-length or incubated for 1 hr at 4° C to facilitate the formation of the complex. The VP1-VP3 complex is also purified by Ni2+ affinity chromatography, followed by a size exclusion chromatography. Finally, the fractions containing the pure complex are pooled and concentrated in 30,000-molecular-weight-cutoff centrifugal concentrators (Figure 3).
Figure 3: Needed VP1 genetic code.
Assembly of VP1/VP3 with the mRNA
These are the steps to assembly the mRNA and the VP1/VP3 genes.
The IPNV RdRP is expressed and purified, and the sΔ+CCC single-stranded RNA template is also generated (Figure 2). The VP1- catalyzed replication assays are incubated with a 50-fold molar excess of the full-length VP3 protein for 10 min on ice before the addition of the ssRNA template and nucleotides. We also add 1 mM ATP (Adenosine triphosphate), GTP (Guanosine-5’-triphosphate), and 0.2 mM CTP (Cytidine triphosphate), UTP (Uridine-5’-triphosphate) supplemented with 0.3 pmol (picomole) [α32P]-UTP. After 2 hr of incubation at 37° C, the reactions are stopped by the addition of 2X loading buffer.
Assembly of VP2. These are the steps to create VP2.
Construction of recombinant plasmids and recombinant bacmid
The Genomic DNA is extracted from a cell-cultured strain 20-06 of PPV (porcine parvovirus) by the phenol-chloroform extraction method. It is used as a template to amplify the VP2 fragment by polymerase chain reaction. The PPV-VP2 gene is amplified with the primers PPV-VP2 FD (porcine parvovirus VP2 protein), containing TATGGATCCGATGAGTCATCATCACCATCACCATAGTGAAAATGTGGAACAAC and PPV-VP2 RV, GCGTCGACTATGAGTTAGAGTTTGTATTAG. The PCR products must be digested with BamHI and SalI and subsequently cloned into the corresponding restriction sites of the pFastbac1 vector to produce the recombinant plasmid, pFast PVP2. The insert of the recombinant plasmid is confirmed by DNA sequencing.
After the recombinant pFastPVP2 giver plasmid is resolved to be right, the DNA is changed into a DH10Bac™. The white colonies contain the recombinant bacmid, and, therefore, they are chosen for isolation of the recombinant bacmid DNA. Before the DNA is separated, up-and-comer colonies were streaked to guarantee they were genuinely white. Bacmid DNA (B-pFastPVP2) is extricated by the phenol-chloroform extraction strategy. The recombinant Bacmid (B-pFastPVP2) is then examined by PCR.
Expression of the VP2 protein in sf9 (Spodoptera frugiperda 9) cells
The recombinant baculoviruses, containing the coding sequences of VP2 with the polyhistidine tag at the N-terminus, are generated via the use of the Bac-to-BacTM system. Propagation of the recombinant virus is carried out in accordance with standard procedures. For manufacturing of the recombinant VP2 proteins, sf9 cells had been grown in 2L Erlenmeyer flasks on orbital shakers at 120 rpm to a concentration of about two × 106 cells per ml of culture medium, in a 30 ml growing volume and contaminated with the recombinant viruses at a multiplicity of infection of 2-3. At seventy-two hr post-infection, cells are collected and processed. The procedure is as follow: The contaminated cells are collected via low-speed centrifugation at 3500 × g swing-out rotor four × 750 ml for 15 min at 4° C and solubilized in 30 ml of ice-cold lysis buffer, with 20 mM Tris, 0.3 M NaCl, 1.0% (v/v) Triton X-100, at a pH of 7.4 for 15 min with mild mixing. The crude cell lysate is clarified through high-speed centrifugation at 23,400 × g for 20 min at 4° C. The supernatant fraction is collected, and the soluble recombinant protein products are purified via IMAC (Immobilized metal affinity chromatography).
Purification of PPV VP2 protein
Cells are harvested at distinct times after infection, centrifuged at 200 × g for 15 min, and resuspended in 25 mM Na2HCO3 with a pH of 8.3, at a density of two × 107 cells/ml. The lysis can occur for 20 min, afterward, cell debris is eliminated by using centrifugation at 10,000 g for 15 min. The recombinant fusion of the VP2 protein is purified employing IMAC. The clarified lysate is incubated with three ml of preequilibrated Ni2+ streamline shelating GelTM on a rotating wheel for sixteen hours at 4° C. Then, it is then placed in a 10 ml chromatography column. The weakly bound and contaminating proteins are washed from the chelating gel through the usage of 10X the column volume with 20 mM Tris, 0.3 M NaCl, and 20 mM imidazole, at a pH of 7.4. The recombinant polyhistidine-tagged protein products are ultimately eluted from the packed bed with 3-4X the column volume, with 20 mM Tris, 0.3 M NaCl, and five hundred mM Mimidazole, at a pH of 7.4. One-ml fractions are collected.
SDS (Sodium Dodecyl Sulfate)-PAGE and western blotting
The purity and the apparent molecular weight of the recombinant VP2 proteins are assessed by using sodium dodecyl sulfatepolyacrylamide gel electrophoresis and immunoblot analysis. The purified proteins are separated by using the SDS-PAGE and are stained by transferring onto nitrocellulose membranes using a moist transfer cell for western blotting. The protein expressed zero to 5 days after insect cells are challenged is obtained for western blotting. The membranes are blocked with 5% skimmed milk in TBS-T, with 50 mM Tris-HCl, one hundred fifty mM NaCl; 0.05% Tween 20, at a pH of 7.5 for 1 hr at room temperature. The Swine anti-PPV (anti porcine parvovirus) sera, with a 1:1000, is introduced to the membranes and shaken overnight at 4° C.
Following the research conducted by the Journal of Virology, the REP genes can be simply created. I used their seven steps because the research conducted by ABM demonstrated that REP genes are not important in rAAV’s process to kill cancer cells.
Recombinant plasmid DNAs
For inducible expression of the AAV-2 Rep proteins, an expression assembly primarily based on the MMTV-LTR (Mouse mammary tumor virus long terminal repeat) is generated. The central HaeIII subfragment of the MMTV-LTR is subcloned in pBluescript collectively with a chicken P-globin (platypus β-globin) polyadenylation signal. On the construct, a tkneo cassette is inserted, yielding plasmid pMTneo. The rep open analyzing body which includes the sequence for the C terminus of the spliced Rep proteins is inserted into pMTneo to yield pMTrep.
The expression constructs for rep4O, which is pCMrep40, rep52 which is pCMrep52, rep68 which is pCMrep68, and rep78 which is pCMrep78 are primarily based on the pKEX, which contains the human cytomegalovirus immediate early promoter. The separated expression of the individual Rep proteins is executed with the aid of mutating the inner translational start AUG, at the position of 993 for the synthesis of rep52 and rep40 proteins in plasmids pCMrep78 and pCMrep68, with the aid of mutating the splice donor site, which is G1907A in the case of pCMrep52 and pCMrep78, or by the way of deleting the intron at the positions of 1907 to 2227 in pCMrep68 and pCMrep40 with the aid of site-directed mutagenesis. The pCMrep78 and pCMrep68 carry two extra mutations which are crucial for the development of the wild-type rep expression plasmid, from which these constructs are derived. The pM1 is proven to be utterly functional concerning complementation of AAV DNA replication and inhibition of DNA amplification.
Anti-Rep antibody
The monoclonal antibody 294-4 is generated by immunizing mice with a bacterially expressed and gel-purified Rep78 protein that is N-terminally truncated by 171 amino acids. Ascites fluid at a dilution of 1:400 is used for immunoblotting, in which all four Rep proteins are recognized.
Cell culture and virus stocks
The HeLa and the HeLa-derived cells clones are maintained at 37° C in a concentration of 5% CO2 in Dulbecco’s modified Eagle’s minimal essential medium supplemented with 5% of fetal calf serum and penicillin-streptomycin. The fetal calf serum is depleted of steroid hormones by activation with charcoal to keep the basal expression level of the MMTV-LTR as low as possible. The adenoviruses of type 2 stocks are prepared. For the preparation of the AAV-2 stocks, we freeze-thaw supernatants of AAV-2 and the Ad2-infected cells are cleared by centrifugation and then treated for 30 min at 56° C in the scope to inactivate the helper adenovirus.
Generation of stably transfected cell lines
Quickly, on the day before transfection, the 2 times 106 HeLa cells are seeded on a dish that has a diameter of 10 centimeters. The pMTrep (20 ug) is linearized with a SspI and is transfected directly. The day after the transfection, the cells are replated at a density of 105 cells per 10 cm diameter dish. One entire day later, the G418 selection is started at a concentration of 1,200 ug of G418 per ml. The rep-expressing cell clones a resubcloned twice by a limitation of dilution.
Transient transfections
One day before the transfection, 106 cells are plated onto dishes with 10 centimeters of diameter. The cells are transfected by a modified calcium phosphate transfection protocol. After overnight incubation at 35° C with a concentration of 3% of CO2, the cells are washed twice with a serum-free medium and then infected with Ad2. After the removal of the virus inoculum, the cells are incubated in a growth medium with 106 M dexamethasone.
Hybridization with labeled oligonucleotides
To discriminate between the replication of the wild-type AAV and the replication of the rep-negative AAV (pTAV2-3), the two oligonucleotides specific for the region surrounding the BamHI site at position 1045, in a mutated AAV in pTAV2-3,are used: the wild-type oligonucleotide at the positions of 1039 to 1058. 5’ GTCCTCCTGGATCCACTGCT 3’, which is an antisense, and the pTAV2-3 oligonucleotide at the positions of 1040 to 1059, 5’ GCAGTGGATCGATCCAGGAG 3’, which is the sense one. The oligonucleotides are end labeled with 32P and are hybridized at 58° C in 6X SSC, 1 × SSC containing 0.15 M NaCl plus 0.015 M sodium citrate-5X Denhardt’s reagent-0.1 mg of yeast tRNA per ml-1% SDS. The filters are washed at 63° C in 6X SSC.
Using the researches in the domain, [1] we decided to create the ITR regions needed for the adenovirus complete replication. They are built by mRNA construction and ligation (Figure 2).
Creation of the AAV
Under the research conducted by ABM, [1] the virus can easily be created. This methodology gave positive results in virology. This methodology is used here because the virus does not have any fabrication specifications. First, we propagate HEK293 cells in PriGrow III Medium (Cat# TM003) with 10% FBS (Cat# TM999) and 1% Pen/ strep (Cat# G255). The day before transfection, we plate the cells in a 15 cm dish. Then, on the day of transfection, we set up the 3-plasmid co-transfection by diluting 12 µg of helper plasmid, 12 µg of rep/cap plasmid, and 10 µg of transgene plasmid in 2.5 ml of serum-free, antibiotic-free medium. Then, the solutions are combined and mixed gently. They are also incubated for 20 minutes at room temperature. Thirdly, after 20 minutes, we add 10 ml of serum-free, antibiotic-free medium to the DNAfectinTM 2100-DNA complex and we mix the solution gently. After that, we remove the growth medium from the HEK293 cells and add the DNAfectinTM 2100-DNA complex solution to the cells. After 5-8 hours, the transfection solution is removed and we add a complete growth medium to the cells. The cells are incubated at 37° C in a CO2 incubator for another 48 hours. Around 48 hours after transfection, the cells are harvested from the 15 cm plate with a cell scraper. After that, we spin the cells at 1,500 × g for 5 minutes to collect the cell pellet and re-suspend it in 0.5 ml lysis buffer (10 mM Tris-HCl (pH-8.5), 150 mM NaCl). Then, we freeze and thaw the cell pellet 3 times by rotating through a dry ice/ethanol bath and a 37° C water bath. Finally, the obtained crude lysate is spun down at 3,000 × g for 10 minutes and we collect the supernatant fraction (Figure 4).
Figure 4: AAV’s genetic code.
The research conducted by Addgenes demonstrated that a new way to purify the rAAV viruses was possible. Their methodology is used because the rAAV does not need any special steps in the purification [2].
Cell and virus culture
The replication-competent, E1+ Ad, which is the RCA (Rolling circle replication), is detected by the ability to plaque or cause a cytopathic effect on monolayers of the A549 cells. The 293-derived cell lines that stably express the Cre recombinase, 293Cre1 and 293Cre4, are propagated in a medium supplemented with 0.4 mg/ml G418.
Construction of AdLC8 and AdLC8c helper virus
The plasmids are constructed following the standard protocols. The AdLC8 helper virus is rescued by the cotransfection of 293 cells with pLC8, a plasmid containing a floxed packaging signal, and the pBHG10. The pLC8 is constructed by the following steps:
A 9.6 kb AscI fragment is removed from the pBG18, a plasmid containing the majority of the Ad genome including the Ad packaging signal and the inverted terminal repeats, generating the pLC4. A synthetic loxP site with BamHI compatible terminals, obtained by the annealition of two single-stranded oligonucleotides, is cloned into a pLC4 at a unique BamHI site, located at nucleotide 188 from the left of the Adenovirus 5 genome, generating the pLC5. A second loxP site 9 is inserted into the pLC5 by introducing the loxP oligo into the BamHI site of pABS (Polyclonal antibodies) 9, generating the pLC7 (Phosphoinositide phospholipase C 7) and the subclonation of a 1.4 kb XbaI fragment, containing the loxP site and a neo-bacterial-expression cassette, into the unique XbaI site of the pLC5 (Phosphoinositide phospholipase C 5). The resulting plasmid, pLC8 (Phosphoinositide phospholipase C 8), contains thus two loxP sites, separated by 1452 bp and flanked by the Ad packaging signal and neo cassette. The AdLC8cluc helper virus is similar to the AdLC8 one, but doesn’t have the neo expression cassette in the E1 (Unimolecular Elimination), and contains the firefly luciferase gene under the regulation of the human cytomegalovirus (CMV) major immediate-early promoter and a simian virus 40 polyadenylation signal is inserted in E3 (ubiquitin ligase) with a stuffer sequence.
Construction of the helper-dependent vector
The pCA35 (principal component analysis 35), which contains the E. coli β-galactosidase (lacZ) ORF (open reading frame) under the control of the murine CMV immediate-early promoter, is digested with SalI, repaired with the Klenow fragment of DNA polymerase, and is recircularized, generating pCA35KS. The murine CMV-lacZ expression cassette is excised from the pCA35KS by digestion with XbaI or BglII and is inserted into XbaI or BamHI. The digestion of the pABS.4 generates the pABS. The 4MClacZ, which is later linearized with SalI and is ligated into the unique XhoI site of pFG140dx3, is generating pUMA10R. As a consequence, the pUMA10R retains Adenovirus-specific sequences corresponding to 5789 bp of the left end and 6143 bp of the right end of the Adenovirus 5. The E1-coding region is disrupted by the insertion of pMX2 at the XbaI site. A 1276- kb SwaI fragment from pUMA10R is removed and replaced by an 8270-bp one from the bacteriophage lambda DNA, generating the pRP1001.
“Rescue” and amplification of AdRP1001
The semiconfluent monolayers of the 293 cells in the dishes of 60 millimeters are transfected with 5 µg of pRP1001 for 4 hr at 37° C, and 18 hr after transfection the cells are infected at a multiplicity of infection of 5 plaque-forming units with the AdLC8. Once the medium is replaced, the cells are incubated until the monolayers show complete cytopathic effect. The cells are scraped into the medium and the virus is released by three rounds of freezing and thawing. An aliquot of the resulting crude viral lysate of 500 µl is serially passaged on the dishes of 60 mm, containing 293Cre4 cells. During each round of amplification of the helper-dependent vector, the 293Cre4 cells are coinfected with the AdLC8 at a multiplicity of infection of 5 for the first two rounds of amplification and a multiplicity of infection of 1 for subsequent passages. The amplification of the AdRP1001 is monitored by assaying aliquots of crude viral lysate after each passage for lacZ-expressing virus on 293 cells, by counting lacZ-positive cells after 5-Bromo-4- chloro-3-indolyl-β-d-galactopyranoside staining as follows: 293 cells are infected with the virus inoculum of 500 µl and are incubated for 24 hr at 37° C. The infected monolayers are washed once with §, fixed with 0.5 ml of 0.2% glutaraldehyde, 2% para-formaldehyde, and 2 mM MgCl2 in PBS- for 5 min at 37° C, washed, and stained with 5 mM K4 Fe(CN)6, 5 mM K3 Fe(CN)6, 2 mM MgCl2 and 1 mg/ml 5-Bromo4-chloro-3-indolyl-β-d-galactopyranoside in PBS. The plates are incubated overnight at room temperature, and the blue-forming units are determined. The viral lysates are also monitored for the helper virus and the RCA by plaque assays on 293 and A549 monolayers, respectively. The large-scale virus preparations of the AdRP1001 are prepared by the infection of dishes of 150 millimeters of 293Cre4 cells with 1 ml of crude AdRP1001 stock per dish plus 2 × 107 pfu of helper virus. After the completion of the cytopathic effect, the purification of AdRP1001 virions is performed by the CsCl (cesium chloride) buoyant density centrifugation, and the fractions are collected through the viral bands and are assayed for the luciferase-expressing virus after a dilution of 1:1000 and the infection of 293 cells.
Injection Solution
• Conservation agents
• Formaldehyde
• Phenol
• 2-phenoxyethanol
• Thimerosal
• Antibiotics: neomycin et polymyxin B
• Stabilators
• Bovine albumin or bovine serum
• Human albumin
• Gelatin
• Wistaria
• Lactose
• Sorbitol
• Sucrose
• Polysorbates 20 or 80
In vitro synthesis of modified mRNA for induction of protein expression in human cells
Construction of the DNA: For the creation of the DNA, it is necessary to include the plasmid DNA into an E. coli culture and to expose it to several chemical and thermal reactions. After that, we obtain a complete DNA containing the CAP and Rep genes and the ITR regions.
Transcription of the DNA: To be transcripted, the DNA has to be exposed to different enzymes and to be exposed to a variation of the temperature. We obtain a full mRNA code containing all the information described in the previous section.
Manufacturing of cap genes
Construction of VP1/VP3: After the expression of VP1 and VP3 in E. Coli, chemicals reactions in the culture of the E. Coli provoke the apparition of VP1/VP3. Then, the mixture is assembled with mRNA. We obtain a VP1/3 genomic complex without the ACKR3 genetic code.
Assembly of VP1/VP3 with the mRNA: To be assembled, these elements must be incubated and to be exposed to different organic elements. We obtain a fully operational complex of VP1/3 DNA.
Assembly of VP2: For the assembly of the VP2 complex, it is necessary to use fetus cells. The Genomic DNA is included in cells to be replicated and to impose the cells to create the VP2 complex. Bacmid is created to be used for the creation of baculoviruses containing the VP2 sequences. After that, the VP2 complex was extracted by a virus. Then, the virus-containing VP2 was eliminated and the VP2 was used. We obtain a VP2 genomic code [3-6].
Manufacturing of Rep genes
The construction of the pP5-repcap-Neo plasmid used to generate the A549-based rep and cap cell lines and the stable transfection, which is the G418 selection, and the screening of initial clones are described. We further need to subclone the initial positive clone, which is called N43, by a series of dilutions, the G418 reselection, and the clonal expansion in 96-well plates, 24-well plates, and plates of 100 millimeters. We rescreen individual subclones for the production of the AAV by the transfection method. We also obtain a REP genetic code which will code the virus replication in the cell.
Plasmid constructs and transfections: We generate the pAAVCMVGFP construct by replacing the Xbal fragment of pSub201 plasmid with a DNA fragment containing the cytomegalovirus early promoter, the enhanced green fluorescent protein gene, and a simian virus-40, having a poly-A signal. We carry out all transient transfection experiments by the usage of Effectene transfection reagent, following the manufacturer’s instructions.
Evaluation of AAV production in rep/cap cell lines: We examine the production of the AAV in rep and cap cell lines by either the staggering infections of helper adenovirus and the Ad-AAV hybrid vector. For the transfection process, we pre-infect the cells with the adenovirus at appropriate MOIs one day before the transfection with the vector plasmid. The production of the AAVCMVGFP per cell is determined on 84-31 cells.
DNA hybridization: We prepare a total cellular DNA using the Qiagen Genomic-tip, which is 20/G, in strict accordance with the manufacturer’s instructions. We analyze the DNA samples of 10 µg for rep and cap sequences following digestion with either BamHI. We hybridize the blots to 32P-labeled probes, either a 2.7-kb cap or an 840-bp rep probe.
Creation of the rAAV
To create the AAV, it was necessary to add into cells HEK293 the AAV’s genome (REP/CAP genes) and a helper virus. The helper virus was AdLC8.
Purification
The virus AdLC8 was rescued by the protein pLC8, a plasmid containing a “floxed” packaging signal, and pBHG10. AdRP1001 was amplified and rescued by several chemical reactions and by the centrifuge force.
The VP1/VP3 complex is responsible for the entrance of the virus into a cell. They contain the amino-acids code of the mutated ACKR3 contact protein. They are important because they are the only way to force the virus to enter cancerous cells only.
Based on the research of “The American Society of Gene Therapy”, I found that VP2 is not essential in the cure. Yet a VP2 complex can easily be created and used without any consequences.
DNA is a major part of the cure. The DNA is used to create the VP1/VP3 capsid protein. When the DNA is synthesized, it has to be transcript into an mRNA code for the protein expression.
When it is performed, it is possible to assemble the mRNA code with the VP1/VP3 complexes to obtain the adapted VP1 and VP3 complexes (which contain the ACKR3 amino-acids code) [7-10].
The Rep genes are responsible for the replication of the modified Adenovirus. That implies the REP genes do not have to be specifically adapted. It is why the standard protocol is used in the research.
The rAAV is designed to deliver its DNA to the cancer cells. By delivering its DNA, it will force the cancerous cells to create other Adenovirus and finally, it will kill theme by lack of ATP.
The purification is necessary and extremely important because the helper gene can be dangerous for the patient’s health.
Also, the efficiency of the adenoviruses to deliver a transgene is limited by the use of classical biological methods. However, this new hypothetical treatment does not require a transgene, this is why it is not affected by the major limitation.
Finally, the immune response is very small [1]. According to ABM, the low damages that the Adenovirus can potentially cause and its low pathogenicity lead to a very mild immune response. This propriety made it the best candidate for a potential cancer cure.
Shortly, due to numerous environmental and genetic factors, the number of new cancer cases will significantly increase, demanding a new way to treat this disease.
As the research has suggested, it is possible to treat cancer with an Adenovirus made in a laboratory. This virus contains the REP and CAP genes closed by the ITR regions. This treatment permits an effective cure of all types of cancers. It will, however, take time and money. Order of the needed equipment, synthesis of the REP and CAP genes are all the steps that are necessary to develop a rAAV that would treat cancer.
The usage of the Adenovirus will greatly increase the success percentage of healing from cancer affecting the designated organs. Also, there will be no need to use radiotherapy, chemotherapy, surgery, immunotherapy, hormone therapy, or the stem cells transplant, which does not provide a success of 100 percent and may have secondary effects that can negatively affect the lives of the patients.
I would like to express my very great appreciation to Dr. Ben Berkhout for his valuable and constructive suggestions during the planning and development of this research work. His willingness to give his time so generously has been very much appreciated.
I also would like to thank Dr. Elena Tap for her extremely valuable advice regarding the redaction of this manuscript.
This article does not contain any studies with human participants performed by any of the authors.
I declare that I have no conflict of interest and that I consent to the publication of this manuscript.
I also acknowledge that I shall make another declaration to state any change in any matter contained in this declaration within one month after the change occurs and shall provide further information on the particulars contained in this declaration if so required by the Treatment of cancer research program.
I hereby declare that I have no pecuniary or other personal interest, direct or indirect, in any matter that raises or may raise a conflict with my duties as a manager of the Treatment of cancer research program.
I made a substantial contribution to the conception, design of the work; the acquisition, analysis, interpretation of data; the creation of new software used in the work; have drafted the work and substantively revised it.
This study was not funded.
- Knowledge Base (2021) Adeno-Associated Virus Production & Modification of AAV. [Ref.]
- Addgene (2021) AAV Purification by Iodixanol Gradient Ultracentrifugation. [Ref.]
- (DNA/RNA) sequence to a protein sequence. [Ref.]
- Billeter MA, Dahlberg JE, Goodman HM, Hindley J, Weissmann C (1969) Sequence of the first 175 nucleotides from the 5’ terminus of Qbeta RNA synthesized in vitro. Nature 224: 1083-1086. [Ref.]
- Avci-Adali M, Behring A, Steinle H, Keller T, Krajeweski S, et al. (2014) In vitro synthesis of modified mRNA for induction of protein expression in human cells. J Vis Exp 13: e51943. [Ref.]
- Bahar MW, Sarin LP, Graham SC, Pang J, Bamford DH, et al. (2013) Structure of a VP1-VP3 complex suggests how birnaviruses package the VP1 polymerase. J Virol 87: 3229-3236. [Ref.]
- New England Biolabs, USA. [Ref.]
- Passeport sante. [Ref.]
- DNA to mRNA to Protein Converter. [Ref.]
- Uniprot (2021) ACKR3 - Atypical chemokine receptor 3-Homo sapiens (Human)-ACKR3 gene & protein. [Ref.]
Download Provisional pdf here
Article Type: RESEARCH ARTICLE
Citation: Bojescu M (2021) Treatment of Cancer. Int J Cancer Res Mol Mech 6(2): dx.doi.org/10.16966/2381-3318.150
Copyright: © 2021 Bojescu M. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Publication history: