Abstract

Polymerase chain reaction (PCR) has been used to improve the identification of Mycobacterium avium subsp. paratuberculosis (MAP). The objective of this study was to compare and validate real-time PCR results of IS900-insertion sequence and nine putative sequences as diagnostic templates to detect MAP. MAP reference strains, field isolates, and non-MAP species were included in the study to validate the specificity of the target genes by PCR detection. All the IS900 insertion sequences and the putative sequences were specifically amplified from the field isolates and reference MAP strains whereas no amplifications were found from the six non-MAP strains. Uniplex and multiplex-PCR of IS900 and putative sequences showed the presence of two distinct amplicons respectively. Furthermore, in silico PCR simulation showed that the primers used in this study for IS900 sequences and the putative sequences amplified only from known MAP and were negative for 63 non-MAP species. Early, accurate and precise diagnostic protocol will assist to track contaminated herds, food products and would ultimately contribute to the control and prevention of Johne’s disease. Based on our results within the size of our samples, the IS900 insertion sequence and the repetitive sequences were amplified only in MAP. The insertion/repetitive sequences targeted in the PCR are not found in the non-MAP species tested in the experiment. Furthermore, the in silico PCR amplification supported the in vivo PCR results.

Keywords

M. avium subsp. Paratuberculosis; IS900 insertion sequence; PCR; Putative sequence; Detection

Introduction

Johne’s disease, caused by Mycobacterium avium subspecies paratuberculosis (MAP), is being increasingly recognized as a significant herd health problem; thus, there is a need for a reliable diagnostic tool for large-scale use to facilitate control and prevention programs and eventually eradicate the disease. MAP is an extremely slow-growing, acidfast and mycobactin-dependent pathogen to grow. Infection with this bacterium leads to a chronic granulomatous enteritis in a broad range of hosts mainly in cattle and other wild and domestic ruminants [1].

Detection of MAP-infected animals poses great difficulties, thus rapid and reliable procedures for the direct detection of MAP in the herd and food samples are still challenging. Efforts have been made in the last few decades to develop protocols for the detection of MAP in feces, milk, tissue, food, and environmental samples using various methods. Fecal culture and serology are the most commonly used tests in the clinical laboratories [1]. The gold standard for Johne’s disease is identification of the etiologic agent, MAP, in tissues that show characteristic histopathologic lesions [2]. Culture will require 8 to 12 weeks and has well known limitations in sensitivity, especially in sub clinically infected cattle, and turnaround time; nonetheless, culture or some other method to detect MAP directly still has a place at certain stages of a Johne’s disease control program [3].

With the development of new molecular techniques, more powerful protocols have become available to improve the detection of MAP. PCR is a powerful method for specific detection of DNA sequences, for which samples can be taken from colostrum, milk, feces, and tissues [4,5]. For molecular detection of MAP, PCR assays targeting various regions specific for MAP were reported from different laboratories. Some of the PCR target genes include MAP-specific genomic sequences such as the insertion sequence IS900, F57 element, IS1311 insertion sequence and hsp X gene [5-7]. Of these, multi-copy IS900 is a target of choice and is the most widely used in the characterization of MAP. The characterization of IS900 insertion sequence, which has 1,451 base pairs and is present as 15 to 20 copies in the MAP genome, has enabled the accurate identification of minimum amounts of bacterial DNA by the polymerase chain reaction (PCR) assay [8]. Furthermore, by suppression subtractive hybridization-based method, nine novel MAP fragments of between 318 and 596 bp have been identified and characterized. A database search revealed little or no similarity with other Mycobacterium species [9].

It is essential to authenticate the existing protocol and targets to have an efficient method for the detection of M. avium subsp. paratuberculosis. The objective of this study was to compare and validate the real-time PCR results of IS900-insertion sequence and nine putative sequences as diagnostic tools to detect MAP.

Materials and Methods

Bacterial strains and growth

Three M. avium subsp. paratuberculosis strains, (baa-968, 19851 and 43015), six non-MAP species (M. fortuitum subsp. fortuitum, M. intracellulare, M. kansasii, M. marinum, M. phlei, and M. scrofulaceum) and 13 MAP clinical isolates were included in this study. The MAP strains and the non-MAP species were purchased from American Type Culture Collection (ATCC, Manassas, VA). The clinical MAP strains, isolated from cattle feces with naturally acquired Johne’s disease, were obtained from Thompson-Bishop-Sparks State Diagnostic Laboratory, Auburn, Alabama. The MAP was grown in Lowenstein-Jensen media (Becton Dickinson and Company, Sparks, MD) and 7H9 broth supplemented with 2 mg of Mycobactin (Difco Laboratories, Detroit, MI).

DNA Extraction

PrepMan kit (Applied Biosystems, Carlsbad, CA) was used to extract DNA from the culture. Briefly, the samples were centrifuged at a medium speed (3 min at 10,000 × g) on a tabletop centrifuge to pellet the cells. After the supernatant has been discarded, the pellet was washed and resuspended in 100 µl of the PrepMan reagent. After brief vortexing, the mixture was boiled at 100°C for 10 min. The preparation was centrifuged, and the supernatant was used as the template for PCR and stored at -20°C for future use. Before PCR assay, the extracted DNA was quantified by ND-1000 spectrophotometer (NanoDrop, Wilmington, DE).

Real-time Polymerase Chain Reaction

The sample preparation, DNA extraction, PCR mixture assembly, and post-PCR analysis were performed in separate laboratory rooms. DNA extracted from the culture was quantified and subjected to real-time PCR. The real-time PCR assay was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, CA). The PCR targets were IS900 insertion sequence and other nine putative sequences [AF503872 (Mptb52.1), AF503873 (Mptb52.16), AF503874 (Mptb52.6), AF503875 (Mptb54.16), AF503876 (Mptb54.24), AF503877 (Mptb54.33), AF503878 (Mptb55.15), AF503879 (Mptb61.32), AF503880 (Mptb62.12)] described and deposited in GenBank [9,10].

Primers specific for the targeted genes (Table 1) were selected from previously published literature and optimized. Controls consisted of reaction mixture alone (negative control) and a positive control containing one µl of genomic DNA from reference M. avium subsp. paratuberculosis (ATCC baa 968, 19851 and 43015). Melting curve profile and conventional gel analysis were performed to confirm the positive PCR results. All realtime PCR assays were performed at least in duplicate using Stratagene Mx3000P® real-time PCR instrument (Stratagene, La Jolla, CA).

Accession (definition)	Primer sequence (5’-3’)	Amplicon size (bp)	Start -End position:	References
AF503872 (Mptb52.1)	F- ATCCGGTGGATCGTCTCGC R- CATCGATTGACGTCCTCACC	371	3332937-3333307	[9]
AF503873 (Mptb52.16)	F- ACGACAACGACCACACTCC R- CACAGGACACTCCATCAGG	396	3907417-3907812	[9]
AF503874 (Mptb52.6 )	F- ATCAACAAGACGTGCGCG R- CAGTGGTGCGCATGAAGTC	266	3327332-3327597	[9]
AF503875 (Mptb54.16)	F- CTTCAACTCGACAAGAGTCGT R- TCAGAAGCGCGACTGGACTT	403	3324756-3325158	[9]
AF503876 (Mptb54.24)	F- GCATGAACAGCAACAGGACC R- TGCGGTGGTAGCAACTAGCC	410	1823028-1823437	[9]
AF503877 (Mptb54.33)	F- GATCTCTACGTGATCAAGGAG R- CGTCGGACAGGCGTATGTAA	415	1823550-1823964	[9]
AF503878 (Mptb55.15)	F- TTGGACGAACTTGGCGATGA R- GGTAATCGGAACCCTTAGCG	546	1825825-1826370	[9]
AF503879 (Mptb61.32)	F- ACGACGTCGTCAGACACCTA R- CGTAGGGTATATCGGGTCAAG	523	29424-29946	[9]
AF503880 (Mptb62.12)	F- CTTGATCCTCGGGAGCGTG R- CTCCGACTGAATGAGCTGTG	474	4262495-4262968	[9]
mHM172613 (IS900)	F-  CCGCTAATTGAGAGATGCGATTGG R-AATCAACTCCAGCAGCGCGGCCTCG	229	4747310-4747538	[10]
F- forward primer and R- reverse primer.

Table 1: Specific primers used in the real-time PCR to amplify IS900 and the putative sequences with the corresponding amplicon size.

Gel electrophoresis

After PCR was completed, 10 µl of the real-time PCR amplification reaction was mixed with GelRed (Biotium, Hayward, CA) mixture and electrophoresed in Tris- acetate-EDTA buffer through a 2% agarose gel. Bands of the appropriate size were identified by comparison with a DNA ladder (Roche Molecular Biochemicals, Indianapolis, IN).

In silico PCR

In silico PCR (virtual PCR) was performed from a sequence database with selected pairs of PCR primers, using an indexing strategy for fast performance. The virtual PCR is considered to have high stringency [11].

The specificity of the primers was confirmed by in silico PCR Amplification against 65 Mycobacterium species. In silico PCR searches a sequence database with a pair of PCR primers, using an indexing strategy for fast performance. This PCR simulation was performed against the most current sequenced Mycobacterium genomes which allow a maximum of 2 mismatches between primers and templates, so the stringency of in silico PCR must be considered high. All the currently available Mycobacterium species sequence data (Table 2) were checked against the selected primers.

S.No	Mycobacterium Species	Strains
1.	Mycobacterium abscessus	ATCC 19977
2.	Mycobacterium abscessus subsp. bolletii	50594
3.	Mycobacterium africanum	GM041182
4.	Mycobacterium avium	104
5.	Mycobacteriumaviumsubsp.paratuberculosis	MAP4
6.	Mycobacterium avium subsp. paratuberculosis str.	k10
7.	Mycobacterium bovis BCG str.	Korea 1168P
8.	Mycobacterium bovis BCG str.	Mexico
9.	Mycobacterium bovis BCG str.	Pasteur 1173P2
10.	Mycobacterium bovis BCG str.	Tokyo 172
11.	Mycobacterium bovis subsp. bovis	AF2122/97
12.	Mycobacterium canettii	CIPT 140010059
13.	Mycobacterium canettii	CIPT 140060008
14.	Mycobacterium canettii	CIPT 140070008
15.	Mycobacterium canettii	CIPT 140070010
16.	Mycobacterium canettii	CIPT 140070017
17.	Mycobacterium chubuense	NBB4
18.	Mycobacterium gilvum	PYR-GCK
19.	Mycobacterium indicus pranii	MTCC 9506
20.	Mycobacterium intracellulare	ATCC 13950
21.	Mycobacterium intracellulare	MOTT-02
22.	Mycobacterium intracellulare	MOTT-64
23.	Mycobacterium kansasii	ATCC 12478
24.	Mycobacterium leprae	Br4923
25.	Mycobacterium leprae strain	TN
26.	Mycobacterium liflandii	128FXT
27.	Mycobacterium marinum	M
28.	Mycobacterium massiliense str.	GO 06
29.	Mycobacterium neoaurum	VKM Ac-1815D
30.	Mycobacterium rhodesiae	NBB3
31.	Mycobacterium smegmatis	JS623
32.	Mycobacterium smegmatis str.	MC2 155
33.	Mycobacterium smegmatis str.	MC2 155
34.	Mycobacterium sp.	JDM601
35.	Mycobacterium sp.	JLS
36.	Mycobacterium sp.	KMS
37.	Mycobacterium sp.	MCS
38.	Mycobacterium sp.	MOTT36Y
39.	Mycobacterium sp.	Spyr1
40.	Mycobacterium tuberculosis	7199-99
41.	Mycobacterium tuberculosis	CAS NITR204
42.	Mycobacterium tuberculosis	CCDC5079
43.	Mycobacterium tuberculosis	CCDC5079
44.	Mycobacterium tuberculosis	CCDC5180
45.	Mycobacterium tuberculosis	CDC1551
46.	Mycobacterium tuberculosis	CTRI-2
47.	Mycobacterium tuberculosis	EAI5
48.	Mycobacterium tuberculosis	EAI5 NITR206
49.	Mycobacterium tuberculosis	F11
50.	Mycobacterium tuberculosis	H37Ra
51.	Mycobacterium tuberculosis	H37Rv
52.	Mycobacterium tuberculosis	H37Rv
53.	Mycobacterium tuberculosis	KZN 1435
54.	Mycobacterium tuberculosis	KZN 4207
55.	Mycobacterium tuberculosis	KZN 605
56.	Mycobacterium tuberculosis	RGTB327
57.	Mycobacterium tuberculosis	RGTB423
58.	Mycobacterium tuberculosis	UT205
59.	Mycobacterium tuberculosis str. Beijing	NITR203
60.	Mycobacterium tuberculosis str. Erdman	= ATCC 35801 DNA
61.	Mycobacterium tuberculosis str. Haarlem
62.	Mycobacterium tuberculosis str. Haarlem	NITR202
63.	Mycobacterium ulcerans	Agy99
64.	Mycobacterium vanbaalenii	PYR-1
65.	Mycobacterium yongonense	05-1390

Table 2: Mycobacterium strains validated using virtual in silico PCR amplification. The corresponding primers are listed in Table 1.

Results and Discussion

Availability of the completed sequences of MAP genome supported the identification of more specific diagnostic sequences [12,13]. The availability of the sequence database brings clarity to unresolved questions surrounding the pathogenesis of MAP in animals and humans and also facilitates the development of detection kits. The introduction of PCR targeting repetitive sequences like IS900 insertion element, which is present in multiple copies in MAP genome, has been reported to reduce the time and labor required for the MAP detection [10]. The primary focus of this study was to evaluate and optimize the specificity of PCR-based molecular detection for the MAP targeting insertion sequence IS900 and other repetitive sequences as uniplex and/or multiplex PCR to detect MAP. To validate the IS900 insertion sequence and the repetitive/putative sequences, appropriate primers were selected/adopted and validated by both real-time PCR and in silico PCR.

Real-time PCR

In this study, the specificity of the real-time PCR assays was optimized by the analysis of genomic DNA from a panel of different Mycobacterium species which includes three MAP reference strains, 13 MAP clinical isolates from cattle and six non-MAP isolates. The genomic DNA samples were subjected to PCR assays targeting IS900 insertion sequence and additional nine putative sequences against MAP and non-MAP cultures as uniplex and also multiplex platforms. The results showed that IS900 and the putative sequence-specific primer pairs were amplified only from genomic DNA extract of the MAP reference strains and clinical MAP isolates. As shown in Figure 1, there is no amplification from the nonMAP strains (M. fortuitum subsp. fortuitum, M. intracellulare, M. kansasii, M. marinum, M. phlei, and M. scrofulaceum). As demonstrated on the gel, the amplicons from MAP were at the expected molecular weight and no signals were detected for the non-MAP species (Figure 2). Uniplex and/ or multiplex-PCR of IS900 insertion sequence and the putative sequences showed the presence of single or two distinct amplicons, respectively (Figure 2). The lower band represented the IS900 sequence amplicon (229 bp), and the top band represents amplicon from Mptb52.1 (371 bp).

Figure 1: Real time PCR of a unique IS900 target sequence amplified from two M. avium subsp. paratuberculosis reference strains (A: ATCC baa-968; B : 43015 B), clinical MAP isolates (C and D) and E: non-MAP species (M. fortuitum subsp. fortuitum, M.intracellulare, M. kansasii, M. marinum, M. phlei, and M. scrofulaceum).

Figure 2: PCR amplification of IS900 and Mptb52.6, putative sequence, from M. avium subsp. paratuberculosis.. PCR products were subjected to 1.5% agarose gel electrophoresis and amplification products were verified by gel electrophoresis. (A) Lane 1, Low DNA Mass Ladder; lanes 2, 3 and 8 PCR product of IS900 Insertion sequence; lanes 4 & 5, PCR product of Mptb52.6; lanes 6 & 7, amplifications of double-PCR product of targeting IS900 & Mptb52.16 sequences.

In silico PCR analysis

This virtual PCR was simulated against up-to-date sequences of Mycobacterium genomes in the database. A total of 23 Mycobacterium spp and 65 strains were verified against IS900 insertion sequence and the other nine repetitive sequences (Table 2). The virtual PCR results showed that IS900 and the putative sequence–specific primer pairs amplified specific targets only from MAP. Furthermore, the in silico simulation results showed that all the primers selected for each of IS900 segment and the putative sequences were amplified only from MAP samples and not from any of the non-MAP species. The amplicon sizes were at the expected range as in published literature and no secondary bands were detected (Figure 3).

Figure 3: In silico PCR amplification results (10 target primers against a total of 65 MAP and non-MAP mycobacterial strains. Mycobacterium strains listed as number 5 (Mycobacterium avium subsp. paratuberculosis MAP4) and number 6 (Mycobacterium avium subsp. paratuberculosis str. k10) were amplified (Refer Table 2 for the Mycobacterium spp. list).

In general Several PCR assays have been developed for the detection of M. avium subsp. paratuberculosis [14,15]. The most prominent target used in several studies to detect DNA of M. avium subsp. paratuberculosis by PCR is the insertion element IS900 [15-17]. The multicopy (17 copies) nature of the IS900 sequence on the M. avium subsp. paratuberculosis chromosome makes it ideal as a target sequence for the detection of MAP, since it exhibits a higher level of sensitivity compared to the use of singlecopy genes as targets [18,19].

The specificity of IS900 diagnostic PCR, however, has been also questioned and some reports indicated the presence of IS900-like sequences in Mycobacterium species other than MAP which may increase the risk of false MAP positive results [20,21]. Rajeev et al. (2005) reported the isolation of one non-MAP Mycobacterium strain positive for IS900 PCR, which has not yet been typed [22].

Some reports described that the problem of false negative PCR results might arise from difficulties in the disruption of the robust cell wall of MAP and insist that the mechanical disruption step may be needed to ensure the maximal release of DNA from MAP cells present in the tissue sample. The efficient procedure to release the DNA could hence maximize the PCR detection sensitivity [10].

In general, the diagnostic performance of IS900 insertion sequencetargeted detection techniques could be limited or misinterpreted due to various factors. These include isolation of organism-specific DNA; origin of the sample; lack of selection of proper primers; PCR amplification in the presence of inhibitory substances in preferred clinical specimens; and also the presence of concurrent Mycobacterium species [1,15]. Furthermore, the possible explanations for this heterogeneity might be host-pathogen interactions, host preference of MAP strains and pathogen adaptation to the environmental factors [10]. Based on the samples tested and the methodology outlined in our study, IS900 and the additional nine putative sequences are specific to use in PCR as uniplex and/or multiplex applications.

Acknowledgement

This work was supported by U.S. Department of Agriculture Grant (USDA/CRIS, Accession 0203750) and USDA/NIFA (GRANT#2011-51110-31082). We would like to thank Dr. Sircy Moore and the bacteriology staff of the Thompson-Bishop-Sparks State Diagnostic Laboratory, Auburn, AL. We acknowledge Dr. David Nganwa for the editing support and Tuskegee University’s College of Veterinary Medicine (CVM) Center of Excellence (Grant #245 5D34HP00001-20-00) for Tuskegee University Shared Instrumentation Core Facility is supported by NIH/NIMHD grant G12MD007585. The summer research support.

References

1. Gilardoni LR, Paolicchi FA, Mundo SL (2012) Bovine paratuberculosis: a review of the advantages and disadvantages of different diagnostic tests. Rev Argent Microbiol 44: 201-215. [Ref.]
2. National Research Council (U.S.), Committee on Diagnosis and Control of Johne’s Disease (2003) Diagnosis and Control of Johne’s Disease. National Academies Press. [Ref.]
3. Collins MT, Gardner IA, Garry FB, Roussel AJ, Wells SJ (2006) Consensus recommendations on diagnostic testing for the detection of paratuberculosis in cattle in the United States. J Am Vet Med Assoc 229: 1912-1919. [Ref.]
4. Safi S, Heidarnejhad O, Mosavari N, Sakha M, Afshar D, et al. (2015) Comparative evaluation of LAMP and Nested-PCR for the diagnosis of bovine paratuberculosis. Int J Mycobacteriol 4: 98-99. [Ref.]
5. Khare S, Ficht TA, Santos RL, Romano J, Ficht AR, et al. (2004) Rapid and sensitive detection of Mycobacterium avium subsp. paratuberculosis in bovine milk and feces by a combination of immunomagnetic bead separation-conventional PCR and real-time PCR. J Clin Microbiol 42: 1075-1081. [Ref.]
6. Green EP, Tizard ML, Moss MT, Thompson J, Winterbourne DJ, et al. (1989) Sequence and characteristics of IS900, an insertion element identified in a human Crohn’s disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res 17: 9063-9073. [Ref.]
7. Whittington R, Marsh I, Choy E, Cousins D (1998) Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species. Mol Cell Probes 12: 349-358. [Ref.]
8. Foddai A, Strain S, Whitlock RH, Elliott CT, Grant IR (2011) Application of a peptide-mediated magnetic separation-phage assay for detection of viable Mycobacterium avium subsp. paratuberculosis to bovine bulk tank milk and feces samples. J Clin Microbiol 49: 2017-2019. [Ref.]
9. Klitgaard Nielsen K, Ahrens P (2002) Putative in vitro expressed gene fragments unique to Mycobacterium avium subspecies paratuberculosis. FEMS Microbiol Lett 214: 199-203. [Ref.]
10. Shin SJ, Chang YF, Huang C, Zhu J, Huang L, et al. (2004) Development of a polymerase chain reaction test to confirm Mycobacterium avium subsp. paratuberculosis in culture. J Vet Diagn Invest 16: 116-120. [Ref.]
11. Bikandi J, San Millán R, Rementeria A, Garaizar J (2004) In silico analysis of complete bacterial genomes: PCR, AFLP- PCR and endonuclease restriction. Bioinformatics 20: 798-799. [Ref.]
12. Khol JL, Pinedo PJ, Buergelt CD, Neumann LM, Rae DO (2014) Lymphatic fluid for the detection of Mycobacterium avium subsp. paratuberculosis in cows by PCR, compared to fecal sampling and detection of antibodies in blood and milk. Vet Microbiol 172: 301- 308. [Ref.]
13. Laurin E, McKenna S, Chaffer M, Keefe G (2015) Sensitivity of solid culture, broth culture, and real-time PCR assays for milk and colostrum samples from Mycobacterium avium ssp. paratuberculosis- infectious dairy cows. J Dairy Sci 98: 8597-8609. [Ref.]
14. Hruska K, Bartos M, Kralik P, Pavlik I (2005) Mycobacterium avium subsp. paratuberculosis in powdered infant milk: paratuberculosis in cattle-the public health problem to be solved. Vet Med-Czech 50: 327- 335.
15. Semret M, Turenne CY, Behr MA (2006) Insertion sequence IS900 revisited. J Clin Microbiol 44: 1081-1083. [Ref.]
16. Kim SG, Shin SJ, Jacobson RH, Miller LJ, Harpending PR, et al. (2002) Development and application of quantitative polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for detection and quantification of Mycobacterium avium subsp. paratuberculosis. J Vet Diagn Invest 14: 126-131. [Ref.]
17. Taddei R, Barbieri I, Pacciarini ML, Fallacara F, Belletti GL, et al. (2008) Mycobacterium porcinum strains isolated from bovine bulk milk: implications for Mycobacterium avium subsp. paratuberculosis detection by PCR and culture. Vet Microbiol 130: 338-347. [Ref.]
18. Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, et al. (2005) The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proc Natl Acad Sci U S A 102: 12344-12349. [Ref.]
19. Soumya MP, Pillai RM, Antony PX, Mukhopadhyay HK, Rao VN (2009) Comparison of fecal culture and IS900 PCR assay for the detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples. Vet Res Commun 33: 781. [Ref.]
20. Englund S, Bolske G, Johansson KE (2002) An IS900-like sequence found in a Mycobacterium sp. other than Mycobacterium avium subsp. paratuberculosis. FEMS Microbiol Lett 209: 267-271. [Ref.]
21. Cousins DV, Whittington R, Marsh I, Masters A, Evans RJ, et al. (1999) Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from the feces of ruminants possess IS900-like sequences detectable IS900 polymerase chain reaction: implications for diagnosis. Mol Cell Probes 13: 431-442. [Ref.]
22. Rajeev S, Zhang Y, Sreevatsan S, Motiwala AS, Byrum B (2005) Evaluation of multiple genomic targets for identification and confirmation of Mycobacterium avium subsp. paratuberculosis isolates using real-time PCR. Vet Microbiol 105: 215-221. [Ref.]

Download Provisional PDF Here

 

Article Information

Article Type: Research Article

Citation: Yehualaeshet T, Graham M, Samuel T, Morton SER, Rodning S, et al. (2017) Comparison and Validation of IS900-Sequence and Putative Sequences as Specific Target to Detect Mycobacterium avium subsp. paratuberculosis. J Anim Sci Res 1(1): doi http://dx.doi.org/10.16966/2576-6457.101

Copyright: © 2017 Yehualaeshet T, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Publication history: 

Received date: 25 May 2017

Accepted date: 17 Jul 2017

Published date: 24 Jul 2017